Skip to main content

Advertisement

Table 1 Specific primer sequences used in this study

From: Sodium dichloroisocyanurate delays ripening and senescence of banana fruit during storage

Gene Query name Primer sequences (5′-3′) Description
MaACS Ma01_t07800.1 F:CGCCGTTGCCAATGACATCCAC R:GAGGTACTGCGTCTGCGAAGAGAT 1-Aminocyclopropane-1-carboxylate synthase CMA101
MaACO GSMUA_AchrUn_randomT20420_001 F:GCACCAAGGTGAGCCACTAT R:TGGAAGAGGAGGATGACACC 1-Aminocyclopropane-1-carboxylate oxidase
MaERF1B GSMUA_Achr11T22020_001 F:ACAAGAAAGCAAAGGAGAGTGAGACGAG R:CAGCAAGTGTTGGCTACTTCTGATGTTC Ethylene-responsive transcription factor 1B
MaEBF1 GSMUA_Achr9T28510_001 F:AGTTGCTCTGTGCTTGATGACCTTGAT R:GGCAGACTCTTCAGTGTAACCTGTGAG Putative EIN3-binding F-box protein1
MaPECS-1 GSMUA_Achr11T05430_001 F:ATATAAAGGCGGGGGCATAC R:CAGACCTGAAGGTGGTCCAT Pectinesterase 3
MaXTH9 GSMUA_Achr6T19100_001 F: GAGGTGGATGGCGAATGGTA R: TCTGCAGTGACCTTGCCGTA Xyloglucan endotransglucosylase/hydrolase
MaACT7 GSMUA_Achr11T12570_001 F:TGGTATGGAAGCCGCTGGTA R:TCTGCTGGAATGTGCTGAGG Actin-7